The short version of Photo-oxidation fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-08-01. Anything still debated is marked as such rather than presented as settled.
Once a peptide is in solution, its stability depends on temperature, pH, ionic strength, and the presence of oxygen or light. Many peptides are less stable in liquid form than as dry powders because hydrolysis, oxidation, and aggregation can proceed faster in water. Storage at low temperature slows these reactions but does not eliminate them. Some sequences are particularly sensitive to repeated freezing and thawing, which can cause precipitation or conformational changes. The container material and headspace also influence adsorption and surface-induced aggregation.
Practical handling often includes dividing a reconstituted solution into single-use aliquots to limit freeze-thaw cycling. Vials made of low-binding plastic or glass with inert closures are common, and some protocols add a carrier protein or bulking agent to reduce adsorption. Filtration through a sterile filter may be used when a sterile solution is required, but filters can retain peptide if binding occurs. Mixing is usually gentle; vigorous vortexing can introduce air-liquid interfaces that promote aggregation. Each of these steps involves trade-offs between sterility, recovery, and analytical accuracy.
The choice of liquid depends on peptide sequence, counterion content, and intended analysis. Water is sufficient for many hydrophilic peptides, while hydrophobic sequences may need a small amount of organic solvent or a buffer. pH can affect charge, solubility, and stability, so the target value is usually selected for the specific peptide. Exact laboratory protocols vary by supplier and application, and no single solvent reliably works for every different peptide.
Reconstitution involves considerably more than simply adding liquid. The solid must wet completely, and gentle mixing should avoid foaming, which can denature some peptides. Insoluble particles may indicate incomplete dissolution, aggregation, or insoluble excipients. The resulting concentration is calculated from the weighed peptide mass and the final volume, not from the volume of liquid added alone. Because peptides can adsorb to surfaces, container material and transfer steps can influence recovery, especially at low concentrations.
Peptide reconstitution refers to dissolving a dried peptide preparation in a liquid to form a solution. The dried form is often produced by lyophilization, a process that removes water under vacuum from a frozen sample. This yields a porous cake or powder that is more stable for transport and storage than many liquid formulations. The term reconstitution is also often used for other dried biological materials, so context matters greatly.
| Property | Value | Notes |
|---|---|---|
| Solution appearance | Clear to slightly opalescent | Cloudiness can signal aggregation or undissolved material. |
| Typical short-term storage | 2-8 °C | Refrigeration is common for solutions used within a short period. |
| Typical long-term storage | -20 °C or lower | Freezing may require aliquoting to avoid repeated freeze-thaw cycles. |
| Common container | Low-binding plastic or glass vial | Low-binding surfaces can reduce adsorptive loss. |
| Common preservative | Bacteriostatic water | Contains an antimicrobial agent; not compatible with all analytical workflows. |
== Human use == Different parts of the plant are used as traditional remedies for disease and skin afflictions. Juice from the leaves is used to treat warts and snakebite, and the flower is applied to burns. This species has been used as indigenous traditional medicine in Asia for rheumatism, fractures, and other ailments. In Korean folk medicine, this impatiens species is used as a medicine called bongseonhwa dae (봉선화대) for the treatment of constipation and gastritis. Chinese people used the plant to treat those bitten by snakes or who ingested poisonous fish. Juice from the stalk, pulverised dried stalks, and pastes from the flowers were also used to treat a variety of ailments. Vietnamese wash their hair with an extract of the plant to stimulate hair growth. One in vitro study found extracts of this impatiens species, especially of the seed pod, to be active against antibiotic-resistant strains of Helicobacter pylori. It is also an inhibitor of 5α-reductases, enzymes that converts testosterone to dihydrotestosterone (active form of testosterone), thus reducing action of testosterone in our body. In Nepal, the balsam leaves are crushed to dye fingernails on the day of Shrawan Sakranti (Shrawan 1). The day is also observed as Luto Faalne Deen (Go Away-Itch Day). Similarly, in China and Korea, the flowers are crushed and mixed with alum to produce an orange dye that can be used to dye fingernails. Unlike common nail varnish, the dye is semi-permanent, requiring dyed nails to grow off over time in order to remove any traces of color.
=== Synthesis === Thrombin is produced by the enzymatic cleavage of two sites on prothrombin by activated Factor X (Xa). The activity of factor Xa is greatly enhanced by binding to activated Factor V (Va), termed the prothrombinase complex. Prothrombin is produced in the liver and is co-translationally modified in a vitamin K-dependent reaction that converts 10-12 glutamic acids in the N terminus of the molecule to gamma-carboxyglutamic acid (Gla). In the presence of calcium, the Gla residues promote the binding of prothrombin to phospholipid bilayers. Deficiency of vitamin K or administration of the anticoagulant warfarin inhibits the production of gamma-carboxyglutamic acid residues, slowing the activation of the coagulation cascade. In human adults, the normal blood level of antithrombin activity has been measured to be around 1.1 units/mL. Newborn levels of thrombin steadily increase after birth to reach normal adult levels, from a level of around 0.5 units/mL 1 day after birth, to a level of around 0.9 units/mL after 6 months of life.
Although he had received 543,895 fewer individual nationwide votes than Gore, Bush won the election, receiving 271 electoral votes to Gore's 266 (Gore had actually been awarded 267 votes by the states pledged to him plus the District of Columbia, but one D.C. elector abstained). Bush was the first person to win a U.S. presidential election with fewer popular votes than another candidate since Benjamin Harrison in 1888.
=== Names === Octodrine is the generic name of the drug and its INNTooltip International Nonproprietary Name and USANTooltip United States Adopted Name. It is also known by its former developmental code name SKF-51.
Sources: en.wikipedia.org
The first launch of a cruise missile (SSM-N-8 Regulus) from a submarine occurred in July 1953, from the deck of USS Tunny, a World War II fleet boat modified to carry the missile with a nuclear warhead. Tunny and its sister boat, Barbero, were the United States' first nuclear deterrent patrol submarines. In the 1950s, nuclear power partially replaced diesel–electric propulsion. Equipment was also developed to extract oxygen from sea water. These two innovations gave submarines the ability to remain submerged for weeks or months. Most of the naval submarines built since that time in the US, the Soviet Union (now Russia), the UK, and France have been powered by a nuclear reactor. In 1959–1960, the first ballistic missile submarines were put into service by both the United States (George Washington class) and the Soviet Union (Golf class) as part of the Cold War nuclear deterrent strategy. During the Cold War, the US and the Soviet Union maintained large submarine fleets that engaged in cat-and-mouse games. The Soviet Union lost at least four submarines during this period: K-129 was lost in 1968 (a part of which the CIA retrieved from the ocean floor with the Howard Hughes-designed ship Glomar Explorer), K-8 in 1970, K-219 in 1986, and Komsomolets in 1989 (which held a depth record among military submarines—1,000 m (3,300 ft)). Many other Soviet subs, such as K-19 (the first Soviet nuclear submarine, and the first Soviet sub to reach the North Pole) were badly damaged by fire or radiation leaks.
== Modifications == As Black Mesa is built on the Source engine, it itself is also moddable with support for the Steam Workshop, and several projects have been started to create versions of Half-Life mods and expansions within Black Mesa.
Since its initial proposal, an expanding body of observational evidence—independent of the hypothesis itself—has reinforced the role of intracrine signaling in various physiological and pathological processes, including immune regulation, metabolic control, and cancer progression.
Two-and-a-half months later, as Darzac's trial opens, Rouletabille reappears sensationally and tells the court that the culprit is Frédéric Larsan himself, whom he accuses of being an alter-ego of a master criminal called Ballmeyer. Larsan appeared to vanish on the two occasions he was nearly collared as he was one of the pursuers. Darzac is released when it emerges that Larsan has vanished after Rouletabille warned him he would accuse him in court. The mystery of the locked Yellow Room is explained thus: Larsan assaulted Mlle. Stangerson earlier in the day than originally thought, but she hid the traces of the attack and locked herself away. During the night, traumatised by the event, she fell off her bed and inflicted the gravest of the wounds by hitting her temple on the corner of her bed-side table. The background to these events is kept secret in court but finally explained by Sainclair. Ballmeyer, in a different guise, had seduced Mlle. Stangerson in her youth and married her secretly in the United States. They had a child before he was arrested and his identity revealed to her. Mlle. Stangerson had arranged for her son's care and education and hidden the whole saga from her father; her silence and Robert Darzac's behaviour were motivated by her desperation to keep him from finding out. Ballmeyer however, hearing that she was engaged, had decided to reappear in her life and claim her as his wife once more, by force if necessary.
== Prognosis == An elevation in serum bilirubin level of more than 2 times ULN with associated transaminase rise indicates severe hepatotoxicity and is likely to lead to mortality in 10% to 15% of patients, especially if the offending drug is not stopped (Hy's Law). This is because it requires significant damage to the liver to impair bilirubin excretion, hence minor impairment (in the absence of biliary obstruction or Gilbert syndrome) would not lead to jaundice. Other poor predictors of outcome are old age, female sex, high AST.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
== Function == PAPPA encodes a secreted metalloproteinase which cleaves insulin-like growth factor–binding proteins (IGFBPs). PAPPA's proteolytic function is activated upon collagen binding. It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses (fetuses with an abnormal number of chromosomes). For example, low PAPPA may be commonly seen in prenatal screening for Down syndrome. Low levels may alternatively predict issues with the placenta, resulting in adverse complications such as intrauterine growth restriction, preeclampsia, placental abruption, premature birth, or fetal death. This enzyme catalyses the following chemical reaction: Cleavage of the Met135-Lys bond in insulin-like growth factor binding protein (IGFBP)-4, and the Ser143-Lys bond in IGFBP-5 This enzyme belongs to the peptidase family M43.
== More on GRK7 == GRK7 is a member of the family of G protein-coupled receptor kinases, and is officially named G protein-coupled receptor kinase 7. GRK7 is found primarily in mammalian retinal cone cells, where it phosphorylates light-activated photopsins, members of the family of G protein-coupled receptors that recognize light of various wavelengths (red, green, blue). Phosphorylated, light-activated photopsin binds to the cone arrestin protein arrestin-4 to terminate the light-activated signaling cascade. The related GRK1, also known as rhodopsin kinase, serves a similar function in retinal rod cells subserving dim light black-and-white peripheral vision outside the fovea. The post-translational modification of GRK7 by geranylgeranylation and α-carboxyl methylation is important for regulating the ability of the enzyme to recognize color opsins in cone outer segment disk membranes. Arrestin-1 bound to rhodopsin in retinal rods prevents rhodopsin activation of the transducin protein to turn off photo-transduction completely. While cone visual transduction is much less well characterized, it is expected that arrestin-4 bound to GRK7-phosphorylated color photopsin prevents opsin activation of the transducin protein to turn off photo-transduction completely.
Berry filed a lawsuit against Gulf Coast Wings, the local franchisee, and later reached a settlement. In 2004, it was found that job applicants to a Hooters in West Covina, California, were secretly filmed while undressing, prompting a civil suit filed against the national restaurant chain in Los Angeles Superior Court. The company responded to the incident with additional employee training. In 2009, Nikolai Grushevski, a man from Corpus Christi, Texas, filed a lawsuit because Hooters would not hire him as a waiter. Grushevski and Hooters reached a confidential settlement on April 13. In September 2009, the US Equal Employment Opportunity Commission filed a lawsuit against a North Carolina charter airline (formerly Hooters Air, owned by Hooters of America) on behalf of Chau Nguyen, an Asian flight attendant fired three years prior after complaining only white workers were being promoted. In May 2010, a lawsuit was filed against Hooters in Michigan after an employee was given a job performance review and was told that her shirt and short size could use some improvement by two women who held positions at the headquarters in Atlanta. Michigan is the only state that includes height and weight as bounds for non-discrimination in hiring. The plaintiff alleges that she was made the offer of a free gym membership and told that if she did not improve in 30 days, her employment would be terminated. The company denied that they threatened to fire the plaintiffs, and the suit was settled out of court.
Plecanatide, sold under the brand name Trulance, is a medication for the treatment of chronic idiopathic constipation (CIC) and irritable bowel syndrome with constipation. It is available in India under the brand name Plectide (OQM Div, MSN Laboratories, India). Plecanatide is an agonist of guanylate cyclase-C. Plecanatide increases intestinal transit and fluid through a buildup of cGMP.
Sources: en.wikipedia.org
Storage time depends on peptide sequence, concentration, solvent, and temperature. No single shelf life applies to all peptides. Stability should be determined by analytical testing for the specific preparation.
Aliquots limit the number of freeze-thaw cycles a solution undergoes. Repeated temperature changes can cause aggregation, precipitation, or loss of peptide to container surfaces. Single-use portions also reduce contamination risk when handled aseptically.
Some amino acid side chains, such as tryptophan and tyrosine, can undergo photo-oxidation. Amber vials or foil wrapping are used to reduce light exposure in laboratory settings. The sensitivity varies widely among peptides.
It is the process of dissolving a dried peptide preparation in a suitable liquid to obtain a solution. The liquid is often water, a buffer, or a water-organic mixture. The procedure is common in laboratory research and analytical work.